Transcript: Mouse NM_008628.2

Mus musculus mutS homolog 2 (Msh2), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Msh2 (17685)
Length:
3056
CDS:
40..2847

Additional Resources:

NCBI RefSeq record:
NM_008628.2
NBCI Gene record:
Msh2 (17685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306592 GTTGGCGTTATGGGTATTAAA pLKO_005 472 CDS 100% 15.000 21.000 N Msh2 n/a
2 TRCN0000042494 CGAGATCATTTCACGGATAAA pLKO.1 2811 CDS 100% 13.200 18.480 N Msh2 n/a
3 TRCN0000327242 CGAGATCATTTCACGGATAAA pLKO_005 2811 CDS 100% 13.200 18.480 N Msh2 n/a
4 TRCN0000042493 CCCGGCAATCTTTCTCAGTTT pLKO.1 412 CDS 100% 4.950 6.930 N Msh2 n/a
5 TRCN0000327318 CCCGGCAATCTTTCTCAGTTT pLKO_005 412 CDS 100% 4.950 6.930 N Msh2 n/a
6 TRCN0000042497 CCGACTGTATCAGGGTATTAA pLKO.1 1254 CDS 100% 15.000 12.000 N Msh2 n/a
7 TRCN0000327316 CCGACTGTATCAGGGTATTAA pLKO_005 1254 CDS 100% 15.000 12.000 N Msh2 n/a
8 TRCN0000042496 GCTCACTTAGACGCCATTGTT pLKO.1 1837 CDS 100% 5.625 3.938 N Msh2 n/a
9 TRCN0000306658 ACCTTTACTGTGTGCTGTTCT pLKO_005 2881 3UTR 100% 4.950 3.465 N Msh2 n/a
10 TRCN0000042495 GCAACGAAGATTGGTGCCTTT pLKO.1 2350 CDS 100% 4.050 2.835 N Msh2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01034 pDONR223 100% 86.5% 92.4% None (many diffs) n/a
2 ccsbBroad304_01034 pLX_304 0% 86.5% 92.4% V5 (many diffs) n/a
3 TRCN0000491945 TGCGAGGTAAGTAATATACCTCCG pLX_317 13% 86.5% 92.4% V5 (many diffs) n/a
Download CSV