Transcript: Mouse NM_008711.2

Mus musculus noggin (Nog), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nog (18121)
Length:
1922
CDS:
540..1238

Additional Resources:

NCBI RefSeq record:
NM_008711.2
NBCI Gene record:
Nog (18121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066293 CCCTAAGGAGAAGGATCTGAA pLKO.1 704 CDS 100% 4.950 3.465 N Nog n/a
2 TRCN0000066296 CGGCCAGCACTATCTACACAT pLKO.1 617 CDS 100% 4.950 3.465 N Nog n/a
3 TRCN0000066294 GCTGAGGAGGAAGTTACAGAT pLKO.1 959 CDS 100% 4.950 3.465 N Nog n/a
4 TRCN0000066297 CGAGATCAAAGGGCTGGAGTT pLKO.1 893 CDS 100% 4.050 2.835 N Nog n/a
5 TRCN0000066295 TCATCGAACATCCAGACCCTA pLKO.1 676 CDS 100% 2.640 1.848 N Nog n/a
6 TRCN0000373045 CCATGCCGAGCGAGATCAAAG pLKO_005 883 CDS 100% 3.600 2.160 N NOG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02118 pDONR223 100% 93.8% 99.1% None (many diffs) n/a
2 ccsbBroad304_02118 pLX_304 0% 93.8% 99.1% V5 (many diffs) n/a
3 TRCN0000475120 GTATTCTACCTGATAGCGCAGATT pLX_317 41.6% 93.8% 99.1% V5 (many diffs) n/a
Download CSV