Transcript: Mouse NM_008714.3

Mus musculus notch 1 (Notch1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Notch1 (18128)
Length:
9497
CDS:
265..7860

Additional Resources:

NCBI RefSeq record:
NM_008714.3
NBCI Gene record:
Notch1 (18128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362664 GAGCGTATGCACCACGATATC pLKO_005 6541 CDS 100% 10.800 15.120 N Notch1 n/a
2 TRCN0000362593 ACGGCGTGAATACCTACAATT pLKO_005 1085 CDS 100% 13.200 10.560 N Notch1 n/a
3 TRCN0000025935 CCCACATTCCAGAGGCATTTA pLKO.1 7835 CDS 100% 13.200 10.560 N Notch1 n/a
4 TRCN0000025908 GCCAGGTTATGAAGGTGTATA pLKO.1 1701 CDS 100% 13.200 10.560 N Notch1 n/a
5 TRCN0000025918 CCGCTGTGAGATTGATGTTAA pLKO.1 1605 CDS 100% 13.200 9.240 N Notch1 n/a
6 TRCN0000025902 GCCCTTTGAGTCTTCATACAT pLKO.1 732 CDS 100% 5.625 3.938 N Notch1 n/a
7 TRCN0000025895 GCAGATGATCTTCCCGTACTA pLKO.1 5103 CDS 100% 4.950 3.465 N Notch1 n/a
8 TRCN0000362592 GAACTGTGTGCAGCGTGTTAA pLKO_005 4110 CDS 100% 13.200 7.920 N Notch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488667 GGGTCATTCGTTCACAAAACCAAG pLX_317 3.9% 85.2% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV