Transcript: Mouse NM_008716.3

Mus musculus notch 3 (Notch3), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Notch3 (18131)
Length:
8054
CDS:
98..7054

Additional Resources:

NCBI RefSeq record:
NM_008716.3
NBCI Gene record:
Notch3 (18131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075569 CGTGTGTAGACGGTGTCAATA pLKO.1 849 CDS 100% 13.200 18.480 N Notch3 n/a
2 TRCN0000301344 CGTGTGTAGACGGTGTCAATA pLKO_005 849 CDS 100% 13.200 18.480 N Notch3 n/a
3 TRCN0000304272 CCACGTGTCTTGACCGAATTG pLKO_005 1431 CDS 100% 10.800 15.120 N Notch3 n/a
4 TRCN0000310868 CGTGATGGCATCAACCGTTAT pLKO_005 2003 CDS 100% 10.800 15.120 N Notch3 n/a
5 TRCN0000075568 GCATTCCAGATAAGACGTGTA pLKO.1 7690 3UTR 100% 4.050 5.670 N Notch3 n/a
6 TRCN0000075572 GTGACAGTTGTGAGGATAATA pLKO.1 3447 CDS 100% 15.000 12.000 N Notch3 n/a
7 TRCN0000304271 TCTGACAAGAGTGAGTTATTA pLKO_005 7345 3UTR 100% 15.000 10.500 N Notch3 n/a
8 TRCN0000075571 CCGGGAGATCACAGATCACTT pLKO.1 6091 CDS 100% 4.950 3.465 N Notch3 n/a
9 TRCN0000075570 GTGTGAATACACAGGGCTCAT pLKO.1 1323 CDS 100% 4.050 2.835 N Notch3 n/a
10 TRCN0000304273 TCACCCTCAGGAGCTACTAAC pLKO_005 4088 CDS 100% 10.800 6.480 N Notch3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489840 GCGCTGGCTCACACTAGACAAAAG pLX_317 3.8% 84.3% 90.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV