Transcript: Mouse NM_008718.2

Mus musculus neuronal PAS domain protein 1 (Npas1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Npas1 (18142)
Length:
2091
CDS:
193..1977

Additional Resources:

NCBI RefSeq record:
NM_008718.2
NBCI Gene record:
Npas1 (18142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095178 GCAATGCTGAAGGTAGTCAAA pLKO.1 1412 CDS 100% 4.950 6.930 N Npas1 n/a
2 TRCN0000095177 GTGTTCGCTTTGAACCAGGAA pLKO.1 640 CDS 100% 2.640 3.696 N Npas1 n/a
3 TRCN0000095176 CGTGCGTCTTAGCGTCACCTA pLKO.1 453 CDS 100% 0.880 1.232 N Npas1 n/a
4 TRCN0000095175 GAGCAGAGTTAGCGACCATAT pLKO.1 1152 CDS 100% 10.800 8.640 N Npas1 n/a
5 TRCN0000095174 GCACGGACACATGATTGTCTT pLKO.1 1095 CDS 100% 4.950 3.465 N Npas1 n/a
6 TRCN0000015291 CCTTCTTTGTCCGCATGAAAT pLKO.1 932 CDS 100% 13.200 9.240 N NPAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06652 pDONR223 100% 83.6% 86.7% None (many diffs) n/a
2 ccsbBroad304_06652 pLX_304 0% 83.6% 86.7% V5 (many diffs) n/a
3 TRCN0000475664 ATCTCGCGCCACCCTAAGAATCAA pLX_317 8.4% 83.6% 86.7% V5 (many diffs) n/a
Download CSV