Transcript: Mouse NM_008760.4

Mus musculus osteoglycin (Ogn), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ogn (18295)
Length:
2540
CDS:
127..1023

Additional Resources:

NCBI RefSeq record:
NM_008760.4
NBCI Gene record:
Ogn (18295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319607 CTAATGACACTCGTTACATTC pLKO_005 896 CDS 100% 10.800 15.120 N Ogn n/a
2 TRCN0000109866 CGTGTAATTCACCTTCAGTTT pLKO.1 835 CDS 100% 4.950 6.930 N Ogn n/a
3 TRCN0000317857 CGTGTAATTCACCTTCAGTTT pLKO_005 835 CDS 100% 4.950 6.930 N Ogn n/a
4 TRCN0000319670 TCACTTACAGATGATACATTC pLKO_005 868 CDS 100% 10.800 8.640 N Ogn n/a
5 TRCN0000146972 CCAGAAAGTCTACGTGTAATT pLKO.1 823 CDS 100% 13.200 9.240 N OGN n/a
6 TRCN0000350082 GATGAAGTTATACCATCATTA pLKO_005 352 CDS 100% 13.200 9.240 N Ogn n/a
7 TRCN0000109865 GCCACAACTATTGCTCTAATA pLKO.1 2245 3UTR 100% 13.200 9.240 N Ogn n/a
8 TRCN0000317858 GCCACAACTATTGCTCTAATA pLKO_005 2245 3UTR 100% 13.200 9.240 N Ogn n/a
9 TRCN0000109867 CGGGAGCGAATTGAAGAGATT pLKO.1 916 CDS 100% 4.950 3.465 N Ogn n/a
10 TRCN0000109868 TGATACATTCTGCAAGGCTAA pLKO.1 879 CDS 100% 4.050 2.835 N Ogn n/a
11 TRCN0000109869 GCTTACTTTACTTAATGCCAA pLKO.1 690 CDS 100% 2.640 1.848 N Ogn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01116 pDONR223 100% 88.8% 85.2% None (many diffs) n/a
2 ccsbBroad304_01116 pLX_304 0% 88.8% 85.2% V5 (many diffs) n/a
3 TRCN0000473686 ATCTCCGAATAAGACCCTTATAAC pLX_317 57.6% 88.8% 85.2% V5 (many diffs) n/a
Download CSV