Transcript: Mouse NM_008766.3

Mus musculus solute carrier family 22 (organic anion transporter), member 6 (Slc22a6), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc22a6 (18399)
Length:
4026
CDS:
301..1938

Additional Resources:

NCBI RefSeq record:
NM_008766.3
NBCI Gene record:
Slc22a6 (18399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079450 GCCATACAATCATTCGCACAT pLKO.1 1535 CDS 100% 4.050 5.670 N Slc22a6 n/a
2 TRCN0000079452 TGTGCTTCCTAGTCATCAATT pLKO.1 1433 CDS 100% 13.200 9.240 N Slc22a6 n/a
3 TRCN0000079449 CCAGGTCTCAACACAAGAGAA pLKO.1 1905 CDS 100% 4.950 3.465 N Slc22a6 n/a
4 TRCN0000079451 CGCTTTCCTTTCCCGCACAAT pLKO.1 538 CDS 100% 4.950 3.465 N Slc22a6 n/a
5 TRCN0000079448 GTCACTTCAATAGACCTACTA pLKO.1 2075 3UTR 100% 4.950 3.465 N Slc22a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02148 pDONR223 100% 84.3% 85.1% None (many diffs) n/a
2 ccsbBroad304_02148 pLX_304 0% 84.3% 85.1% V5 (many diffs) n/a
3 TRCN0000467768 TCATTTATGGGGTCACTTTGATGC pLX_317 11.6% 84.3% 85.1% V5 (many diffs) n/a
Download CSV