Transcript: Mouse NM_008815.3

Mus musculus ets variant 4 (Etv4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Etv4 (18612)
Length:
2349
CDS:
255..1712

Additional Resources:

NCBI RefSeq record:
NM_008815.3
NBCI Gene record:
Etv4 (18612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295466 TGGAGGCAGGCCAAATCTAAA pLKO_005 1890 3UTR 100% 13.200 18.480 N Etv4 n/a
2 TRCN0000055128 GCTGCGATACTATTATGAGAA pLKO.1 1451 CDS 100% 4.950 6.930 N Etv4 n/a
3 TRCN0000055131 CCAGATAATCAACGTCCAGCT pLKO.1 1554 CDS 100% 2.160 3.024 N Etv4 n/a
4 TRCN0000295522 TCGGCCACAGAGGTGGATATT pLKO_005 1684 CDS 100% 13.200 10.560 N Etv4 n/a
5 TRCN0000295465 GCAGCAAATCTCCCGGAAATG pLKO_005 310 CDS 100% 10.800 7.560 N Etv4 n/a
6 TRCN0000295467 GTCCCTGGATGTGCATCAATG pLKO_005 1071 CDS 100% 10.800 7.560 N Etv4 n/a
7 TRCN0000055129 CCCAACAAATGCTCATTTCAT pLKO.1 1316 CDS 100% 5.625 3.938 N Etv4 n/a
8 TRCN0000055132 GTGATGGGTTATGGCTATGAA pLKO.1 1137 CDS 100% 5.625 3.938 N Etv4 n/a
9 TRCN0000306806 GTGATGGGTTATGGCTATGAA pLKO_005 1137 CDS 100% 5.625 3.938 N Etv4 n/a
10 TRCN0000055130 GCGGAGGATGAAAGGCGGATA pLKO.1 260 CDS 100% 1.350 0.945 N Etv4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10810 pDONR223 100% 38.3% 40.8% None (many diffs) n/a
2 ccsbBroad304_10810 pLX_304 0% 38.3% 40.8% V5 (many diffs) n/a
3 TRCN0000470102 ATAGCCTCATCACGTTTCCTCCGA pLX_317 66.6% 38.3% 40.8% V5 (many diffs) n/a
Download CSV