Transcript: Mouse NM_008820.2

Mus musculus peptidase D (Pepd), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pepd (18624)
Length:
1856
CDS:
32..1513

Additional Resources:

NCBI RefSeq record:
NM_008820.2
NBCI Gene record:
Pepd (18624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031906 CGAGGGCATTAGCAAGTTCAA pLKO.1 520 CDS 100% 4.950 6.930 N Pepd n/a
2 TRCN0000031907 CGTGAGGTAATGAAGGCTGTA pLKO.1 650 CDS 100% 4.050 3.240 N Pepd n/a
3 TRCN0000295141 CGATCAAGGATGGAGATATTT pLKO_005 828 CDS 100% 15.000 10.500 N Pepd n/a
4 TRCN0000295190 GATCCATTCCAAGGAGTATTT pLKO_005 361 CDS 100% 13.200 9.240 N Pepd n/a
5 TRCN0000031904 GCTTAAATGATAGGGACTTAA pLKO.1 1700 3UTR 100% 13.200 9.240 N Pepd n/a
6 TRCN0000295140 AGATCCTGGAGATCACATTTG pLKO_005 1596 3UTR 100% 10.800 7.560 N Pepd n/a
7 TRCN0000031905 CCACACCTCTTACACCTGTAT pLKO.1 742 CDS 100% 4.950 3.465 N Pepd n/a
8 TRCN0000318188 CCACACCTCTTACACCTGTAT pLKO_005 742 CDS 100% 4.950 3.465 N Pepd n/a
9 TRCN0000031908 CCGAGTGTTCAAGACAGACAT pLKO.1 580 CDS 100% 4.950 3.465 N Pepd n/a
10 TRCN0000318190 CCGAGTGTTCAAGACAGACAT pLKO_005 580 CDS 100% 4.950 3.465 N Pepd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01172 pDONR223 100% 84.1% 89% None (many diffs) n/a
2 ccsbBroad304_01172 pLX_304 0% 84.1% 89% V5 (many diffs) n/a
3 TRCN0000467094 CAAGTGTCCTCTAGTGCTCAAACC pLX_317 27.6% 84.1% 89% V5 (many diffs) n/a
Download CSV