Transcript: Mouse NM_008874.4

Mus musculus phospholipase C, beta 3 (Plcb3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Plcb3 (18797)
Length:
4273
CDS:
170..3874

Additional Resources:

NCBI RefSeq record:
NM_008874.4
NBCI Gene record:
Plcb3 (18797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008874.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076914 CGCGGGAGTAAGTTCATCAAA pLKO.1 239 CDS 100% 5.625 7.875 N Plcb3 n/a
2 TRCN0000076913 CCCATAACATTCACCTAAGAT pLKO.1 4102 3UTR 100% 5.625 4.500 N Plcb3 n/a
3 TRCN0000332215 CCCATAACATTCACCTAAGAT pLKO_005 4102 3UTR 100% 5.625 4.500 N Plcb3 n/a
4 TRCN0000076916 CTGATGAGTTTCCCTTGGAAA pLKO.1 783 CDS 100% 4.950 3.465 N Plcb3 n/a
5 TRCN0000332150 CTGATGAGTTTCCCTTGGAAA pLKO_005 783 CDS 100% 4.950 3.465 N Plcb3 n/a
6 TRCN0000076917 GCTGAATGAAAGGGAGAAGAA pLKO.1 3424 CDS 100% 4.950 3.465 N Plcb3 n/a
7 TRCN0000332148 GCTGAATGAAAGGGAGAAGAA pLKO_005 3424 CDS 100% 4.950 3.465 N Plcb3 n/a
8 TRCN0000076915 GCTTCTGACTACATCCCAGAT pLKO.1 2702 CDS 100% 4.050 2.835 N Plcb3 n/a
9 TRCN0000332217 GCTTCTGACTACATCCCAGAT pLKO_005 2702 CDS 100% 4.050 2.835 N Plcb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008874.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.