Transcript: Mouse NM_008914.3

Mus musculus protein phosphatase 3, catalytic subunit, beta isoform (Ppp3cb), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ppp3cb (19056)
Length:
3848
CDS:
134..1711

Additional Resources:

NCBI RefSeq record:
NM_008914.3
NBCI Gene record:
Ppp3cb (19056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008914.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081284 CGTCGTCAAAGCTGTTCCTTT pLKO.1 208 CDS 100% 4.950 6.930 N Ppp3cb n/a
2 TRCN0000288483 CGTCGTCAAAGCTGTTCCTTT pLKO_005 208 CDS 100% 4.950 6.930 N Ppp3cb n/a
3 TRCN0000081283 GCCGTCTATAAGATTGGGTAA pLKO.1 1888 3UTR 100% 4.050 5.670 N Ppp3cb n/a
4 TRCN0000002810 CCTGCTAATACACGATACCTT pLKO.1 482 CDS 100% 3.000 4.200 N PPP3CB n/a
5 TRCN0000277929 CCTGCTAATACACGATACCTT pLKO_005 482 CDS 100% 3.000 4.200 N PPP3CB n/a
6 TRCN0000002814 CCCGGAAAGAAATCATAAGAA pLKO.1 1335 CDS 100% 5.625 4.500 N PPP3CB n/a
7 TRCN0000286057 CCCGGAAAGAAATCATAAGAA pLKO_005 1335 CDS 100% 5.625 4.500 N PPP3CB n/a
8 TRCN0000081285 CAGCCCGGAAAGAAATCATAA pLKO.1 1332 CDS 100% 13.200 9.240 N Ppp3cb n/a
9 TRCN0000288484 CAGCCCGGAAAGAAATCATAA pLKO_005 1332 CDS 100% 13.200 9.240 N Ppp3cb n/a
10 TRCN0000002811 CTGGATGATATTAGGAGATTA pLKO.1 785 CDS 100% 13.200 9.240 N PPP3CB n/a
11 TRCN0000277879 CTGGATGATATTAGGAGATTA pLKO_005 785 CDS 100% 13.200 9.240 N PPP3CB n/a
12 TRCN0000351048 GGTAAATGTTCTGAGTATTTG pLKO_005 1255 CDS 100% 13.200 9.240 N Ppp3cb n/a
13 TRCN0000081286 TGATGAACATTCGACAGTTTA pLKO.1 1143 CDS 100% 13.200 9.240 N Ppp3cb n/a
14 TRCN0000340116 TGGGACTTGTGCCGTCTATAA pLKO_005 1878 3UTR 100% 13.200 9.240 N Ppp3cb n/a
15 TRCN0000081287 GTGATGAACATTCGACAGTTT pLKO.1 1142 CDS 100% 4.950 3.465 N Ppp3cb n/a
16 TRCN0000288485 GTGATGAACATTCGACAGTTT pLKO_005 1142 CDS 100% 4.950 3.465 N Ppp3cb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008914.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01268 pDONR223 100% 95.9% 99.2% None (many diffs) n/a
2 ccsbBroad304_01268 pLX_304 0% 95.9% 99.2% V5 (many diffs) n/a
3 TRCN0000477952 ATGCTTACCCTTTCTTTGTCTCAC pLX_317 9.7% 95.9% 99.2% V5 (many diffs) n/a
Download CSV