Transcript: Mouse NM_008929.3

Mus musculus DnaJ heat shock protein family (Hsp40) member C3 (Dnajc3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dnajc3 (100037258)
Length:
5190
CDS:
158..1672

Additional Resources:

NCBI RefSeq record:
NM_008929.3
NBCI Gene record:
Dnajc3 (100037258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008551 CGGACCGTTCAGATTTAAGTT pLKO.1 1639 CDS 100% 5.625 7.875 N Dnajc3 n/a
2 TRCN0000008552 CGATAACTATATCGCATACTA pLKO.1 361 CDS 100% 0.563 0.788 N Dnajc3 n/a
3 TRCN0000008550 CCAGATAATTTCCAGAATGAA pLKO.1 1424 CDS 100% 5.625 3.938 N Dnajc3 n/a
4 TRCN0000008548 GCTGAGCTTATTGTAGACTTA pLKO.1 1811 3UTR 100% 4.950 3.465 N Dnajc3 n/a
5 TRCN0000008549 GCGAGCAGAATGCTTCATAAA pLKO.1 736 CDS 100% 13.200 7.920 N Dnajc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01293 pDONR223 100% 87.5% 96.8% None (many diffs) n/a
2 ccsbBroad304_01293 pLX_304 0% 87.5% 96.8% V5 (many diffs) n/a
3 TRCN0000466430 AGCAGCAGATACCCGAAGAAGGCT pLX_317 28.9% 87.5% 96.8% V5 (many diffs) n/a
Download CSV