Transcript: Mouse NM_008943.2

Mus musculus presenilin 1 (Psen1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Psen1 (19164)
Length:
3023
CDS:
492..1895

Additional Resources:

NCBI RefSeq record:
NM_008943.2
NBCI Gene record:
Psen1 (19164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054507 GACGAAGAGCTGACATTGAAA pLKO.1 699 CDS 100% 5.625 7.875 N Psen1 n/a
2 TRCN0000298377 GACGAAGAGCTGACATTGAAA pLKO_005 699 CDS 100% 5.625 7.875 N Psen1 n/a
3 TRCN0000054505 CCTGTGCCTTACATTACTCCT pLKO.1 1742 CDS 100% 2.640 3.696 N Psen1 n/a
4 TRCN0000287723 CCTGTGCCTTACATTACTCCT pLKO_005 1742 CDS 100% 2.640 3.696 N Psen1 n/a
5 TRCN0000030523 GCAGGCGTATCTCATTATGAT pLKO.1 1157 CDS 100% 5.625 4.500 N Psen1 n/a
6 TRCN0000030522 CCTGTATAAATACAGGTGCTA pLKO.1 947 CDS 100% 0.264 0.211 N Psen1 n/a
7 TRCN0000054504 CGTTACAGTAGCACTCCTAAT pLKO.1 1076 CDS 100% 10.800 7.560 N Psen1 n/a
8 TRCN0000287725 CGTTACAGTAGCACTCCTAAT pLKO_005 1076 CDS 100% 10.800 7.560 N Psen1 n/a
9 TRCN0000030521 GCTGTGATTTCAGTATATGAT pLKO.1 1242 CDS 100% 5.625 3.938 N Psen1 n/a
10 TRCN0000295137 GCTGTGATTTCAGTATATGAT pLKO_005 1242 CDS 100% 5.625 3.938 N Psen1 n/a
11 TRCN0000030520 CCAACTTGCATTCCATCAGTT pLKO.1 1865 CDS 100% 4.950 3.465 N Psen1 n/a
12 TRCN0000030519 CCACTTCGTATGCTGGTTGAA pLKO.1 1290 CDS 100% 4.950 3.465 N Psen1 n/a
13 TRCN0000054506 CCAGGAACTTTCTGGGAGCAT pLKO.1 1574 CDS 100% 2.640 1.848 N Psen1 n/a
14 TRCN0000287724 CCAGGAACTTTCTGGGAGCAT pLKO_005 1574 CDS 100% 2.640 1.848 N Psen1 n/a
15 TRCN0000054503 CAAGCATGTCATCATGCTCTT pLKO.1 728 CDS 100% 0.405 0.284 N Psen1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01304 pDONR223 100% 86.6% 92% None (many diffs) n/a
2 ccsbBroad304_01304 pLX_304 0% 86.6% 92% V5 (many diffs) n/a
3 TRCN0000474352 GGGTTTAATCACTCTCGTTGCGCG pLX_317 12.7% 86.6% 92% V5 (many diffs) n/a
Download CSV