Transcript: Mouse NM_008974.4

Mus musculus protein tyrosine phosphatase 4a2 (Ptp4a2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptp4a2 (19244)
Length:
3413
CDS:
729..1232

Additional Resources:

NCBI RefSeq record:
NM_008974.4
NBCI Gene record:
Ptp4a2 (19244)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008974.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029001 GAATGCGGAATGAAGTATGAA pLKO.1 1080 CDS 100% 5.625 7.875 N Ptp4a2 n/a
2 TRCN0000337919 GAATGCGGAATGAAGTATGAA pLKO_005 1080 CDS 100% 5.625 7.875 N Ptp4a2 n/a
3 TRCN0000028999 CCTAATCAGATAGTAGATGAT pLKO.1 948 CDS 100% 4.950 6.930 N Ptp4a2 n/a
4 TRCN0000029002 GTTACGCTTCAGAGATACCAA pLKO.1 1190 CDS 100% 3.000 2.400 N Ptp4a2 n/a
5 TRCN0000337920 GTTACGCTTCAGAGATACCAA pLKO_005 1190 CDS 100% 3.000 2.400 N Ptp4a2 n/a
6 TRCN0000350266 TTTCTGCCAGGATTGAATTAT pLKO_005 1477 3UTR 100% 15.000 10.500 N PTP4A2 n/a
7 TRCN0000337988 GCTGTGTTCAGTAGAAGTAGA pLKO_005 1219 CDS 100% 4.950 3.465 N Ptp4a2 n/a
8 TRCN0000029000 CTCTTATGAGAACATGCGTTT pLKO.1 755 CDS 100% 4.050 2.835 N Ptp4a2 n/a
9 TRCN0000337918 CTCTTATGAGAACATGCGTTT pLKO_005 755 CDS 100% 4.050 2.835 N Ptp4a2 n/a
10 TRCN0000010748 TGGTTCGAGTTTGTGATGCTA pLKO.1 853 CDS 100% 3.000 2.100 N PTP4A2 n/a
11 TRCN0000029003 CAGTGCATTGTGTTGCAGGAT pLKO.1 1021 CDS 100% 2.640 1.848 N Ptp4a2 n/a
12 TRCN0000002924 CTTCAGAGATACCAATGGGCA pLKO.1 1196 CDS 100% 0.660 0.462 N PTP4A2 n/a
13 TRCN0000272607 CTTCAGAGATACCAATGGGCA pLKO_005 1196 CDS 100% 0.660 0.462 N PTP4A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008974.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01859 pDONR223 100% 95.4% 100% None (many diffs) n/a
2 ccsbBroad304_01859 pLX_304 0% 95.4% 100% V5 (many diffs) n/a
3 TRCN0000474197 TGACCAAGTCCCTTATTCCACGCC pLX_317 88.8% 95.4% 100% V5 (many diffs) n/a
Download CSV