Transcript: Mouse NM_009011.4

Mus musculus RAD23 homolog B, nucleotide excision repair protein (Rad23b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rad23b (19359)
Length:
3827
CDS:
321..1571

Additional Resources:

NCBI RefSeq record:
NM_009011.4
NBCI Gene record:
Rad23b (19359)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127119 CCGCCTTTACAGGTCGTTATT pLKO.1 1803 3UTR 100% 13.200 18.480 N Rad23b n/a
2 TRCN0000325305 CCGCCTTTACAGGTCGTTATT pLKO_005 1803 3UTR 100% 13.200 18.480 N Rad23b n/a
3 TRCN0000127122 GACTTGTGATTCAAGCATATT pLKO.1 1483 CDS 100% 13.200 18.480 N Rad23b n/a
4 TRCN0000325377 GACTTGTGATTCAAGCATATT pLKO_005 1483 CDS 100% 13.200 18.480 N Rad23b n/a
5 TRCN0000127120 GCAGGTCAGAAGTTAATTTAT pLKO.1 444 CDS 100% 15.000 10.500 N Rad23b n/a
6 TRCN0000325372 GCAGGTCAGAAGTTAATTTAT pLKO_005 444 CDS 100% 15.000 10.500 N Rad23b n/a
7 TRCN0000127123 GATACTGCTCTCAAAGAATAT pLKO.1 486 CDS 100% 13.200 9.240 N Rad23b n/a
8 TRCN0000325303 GATACTGCTCTCAAAGAATAT pLKO_005 486 CDS 100% 13.200 9.240 N Rad23b n/a
9 TRCN0000127121 GCTATGAACGAGAACAAGTAA pLKO.1 922 CDS 100% 5.625 3.938 N Rad23b n/a
10 TRCN0000325307 GCTATGAACGAGAACAAGTAA pLKO_005 922 CDS 100% 5.625 3.938 N Rad23b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06836 pDONR223 100% 86.6% 89.2% None (many diffs) n/a
2 ccsbBroad304_06836 pLX_304 46.9% 86.6% 89.2% V5 (many diffs) n/a
3 TRCN0000467239 ATTCAGTTTTGCAGACGGGCGGCA pLX_317 24.7% 86.6% 89.2% V5 (many diffs) n/a
Download CSV