Transcript: Mouse NM_009029.2

Mus musculus RB transcriptional corepressor 1 (Rb1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rb1 (19645)
Length:
4642
CDS:
151..2916

Additional Resources:

NCBI RefSeq record:
NM_009029.2
NBCI Gene record:
Rb1 (19645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235830 CATCGGAGTACAGCGATATAA pLKO_005 1452 CDS 100% 15.000 21.000 N Rb1 n/a
2 TRCN0000235829 TAGCATATCTCCGACTAAATA pLKO_005 2099 CDS 100% 15.000 21.000 N Rb1 n/a
3 TRCN0000042546 CGCTATGAAGAAGTTTATCTT pLKO.1 1090 CDS 100% 5.625 7.875 N Rb1 n/a
4 TRCN0000055380 GCAGTGCGTTATCTACTGAAA pLKO.1 665 CDS 100% 4.950 6.930 N Rb1 n/a
5 TRCN0000042547 CGTCTAGCATATCTCCGACTA pLKO.1 2095 CDS 100% 4.050 5.670 N Rb1 n/a
6 TRCN0000055382 CCGACATTTGGACCAGATTAT pLKO.1 2220 CDS 100% 13.200 10.560 N Rb1 n/a
7 TRCN0000042544 CCACTCGAACACGAATGCAAA pLKO.1 2846 CDS 100% 4.950 3.960 N Rb1 n/a
8 TRCN0000055381 GAGTCCAAATTCCAACAGAAA pLKO.1 2809 CDS 100% 4.950 3.960 N Rb1 n/a
9 TRCN0000235831 TAAGCCAATCTGGTCTAATAA pLKO_005 3980 3UTR 100% 15.000 10.500 N Rb1 n/a
10 TRCN0000218099 GTGGATTCTGAACGTACTTAA pLKO_005 1677 CDS 100% 13.200 9.240 N Rb1 n/a
11 TRCN0000042545 CCGATTGTATTACCGTGTGAT pLKO.1 1482 CDS 100% 4.950 3.465 N Rb1 n/a
12 TRCN0000042543 CCGTGGATTCTGAACGTACTT pLKO.1 1675 CDS 100% 4.950 3.465 N Rb1 n/a
13 TRCN0000055379 GCACATCATCTGGACTCTGTT pLKO.1 2160 CDS 100% 4.950 3.465 N Rb1 n/a
14 TRCN0000055378 GCCAGGCTTGAGTTTGAAGAA pLKO.1 265 CDS 100% 4.950 3.465 N Rb1 n/a
15 TRCN0000218613 TACCAGTACCAAGGTTGATAA pLKO_005 549 CDS 100% 0.000 0.000 N Rb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06846 pDONR223 99.7% 88.1% 90.6% None (many diffs) n/a
2 ccsbBroad304_06846 pLX_304 22.8% 88.1% 90.6% V5 (many diffs) n/a
Download CSV