Transcript: Mouse NM_009037.2

Mus musculus reticulocalbin 1 (Rcn1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rcn1 (19672)
Length:
3063
CDS:
115..1092

Additional Resources:

NCBI RefSeq record:
NM_009037.2
NBCI Gene record:
Rcn1 (19672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104604 CTGGTGTACGAGTCAGACAAA pLKO.1 958 CDS 100% 4.950 3.960 N Rcn1 n/a
2 TRCN0000104600 CCGCTGTGTATTTGAACTATT pLKO.1 1450 3UTR 100% 13.200 9.240 N Rcn1 n/a
3 TRCN0000104602 GCTAAAGTCTGGAAGGATTAT pLKO.1 457 CDS 100% 13.200 9.240 N Rcn1 n/a
4 TRCN0000104603 GAGCTGAAACTTTGGATCAAA pLKO.1 403 CDS 100% 5.625 3.938 N Rcn1 n/a
5 TRCN0000104601 CCGCTGAATTCCATGATAGTT pLKO.1 551 CDS 100% 0.000 0.000 N Rcn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01384 pDONR223 100% 87.8% 94.5% None (many diffs) n/a
2 ccsbBroad304_01384 pLX_304 0% 87.8% 94.5% V5 (many diffs) n/a
3 TRCN0000466278 TCGTCGCATGACCCCCTGATAATT pLX_317 28.1% 87.8% 94.5% V5 (many diffs) n/a
Download CSV