Transcript: Mouse NM_009041.3

Mus musculus radixin (Rdx), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Rdx (19684)
Length:
4580
CDS:
553..2304

Additional Resources:

NCBI RefSeq record:
NM_009041.3
NBCI Gene record:
Rdx (19684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009041.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062433 GCCTTATGTATGGGAAACCAT pLKO.1 1396 CDS 100% 3.000 4.200 N RDX n/a
2 TRCN0000072058 CGTGATAAGTACAAGACCCTT pLKO.1 2227 CDS 100% 2.640 3.696 N Rdx n/a
3 TRCN0000377087 CCTCGTCTGAGAATCAATAAA pLKO_005 1366 CDS 100% 15.000 10.500 N Rdx n/a
4 TRCN0000377088 AGCTAGAAAGGGCACAATTAG pLKO_005 1502 CDS 100% 13.200 9.240 N Rdx n/a
5 TRCN0000363893 TAATGGCCACGTCTGACAAAT pLKO_005 2596 3UTR 100% 13.200 9.240 N Rdx n/a
6 TRCN0000072061 CAAGTTAAAGAAGCCATCTTA pLKO.1 865 CDS 100% 5.625 3.938 N Rdx n/a
7 TRCN0000352040 CAAGTTAAAGAAGCCATCTTA pLKO_005 865 CDS 100% 5.625 3.938 N Rdx n/a
8 TRCN0000072060 CCCAATACAACTGGCAAACAA pLKO.1 616 CDS 100% 5.625 3.938 N Rdx n/a
9 TRCN0000072059 GCGCAAGATCTAGAGATGTAT pLKO.1 1135 CDS 100% 5.625 3.938 N Rdx n/a
10 TRCN0000352120 GCGCAAGATCTAGAGATGTAT pLKO_005 1135 CDS 100% 5.625 3.938 N Rdx n/a
11 TRCN0000062437 GCTAAATTCTTTCCTGAAGAT pLKO.1 796 CDS 100% 4.950 3.465 N RDX n/a
12 TRCN0000072062 GTTCAGAATTAGCCCAAGCTA pLKO.1 2147 CDS 100% 3.000 2.100 N Rdx n/a
13 TRCN0000352042 GTTCAGAATTAGCCCAAGCTA pLKO_005 2147 CDS 100% 3.000 2.100 N Rdx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009041.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06855 pDONR223 100% 90% 98.2% None (many diffs) n/a
2 ccsbBroad304_06855 pLX_304 0% 90% 98.2% V5 (many diffs) n/a
3 TRCN0000478656 TTCCGTTTGGCCTCCTGAACCAAT pLX_317 19.3% 90% 98.2% V5 (many diffs) n/a
Download CSV