Transcript: Mouse NM_009065.2

Mus musculus Ras-like without CAAX 2 (Rit2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rit2 (19762)
Length:
1851
CDS:
186..839

Additional Resources:

NCBI RefSeq record:
NM_009065.2
NBCI Gene record:
Rit2 (19762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047946 CAGAGAGTACAAGGTGGTAAT pLKO.1 239 CDS 100% 10.800 8.640 N RIT2 n/a
2 TRCN0000077610 GCCTGCTTACTTAGACATCTT pLKO.1 383 CDS 100% 4.950 3.960 N Rit2 n/a
3 TRCN0000077608 GCTGGAATAGTTTAGAGGAAA pLKO.1 1291 3UTR 100% 4.950 3.960 N Rit2 n/a
4 TRCN0000077609 GCAGTCACAATGCAGTTTATA pLKO.1 288 CDS 100% 15.000 10.500 N Rit2 n/a
5 TRCN0000077611 CAAGGCTTAGTGAGAGAAATT pLKO.1 708 CDS 100% 13.200 7.920 N Rit2 n/a
6 TRCN0000077612 GCCAAGTTCAAGGAGCTTATT pLKO.1 516 CDS 100% 13.200 7.920 N Rit2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06865 pDONR223 100% 86.3% 91.2% None (many diffs) n/a
2 ccsbBroad304_06865 pLX_304 0% 86.3% 91.2% V5 (many diffs) n/a
3 TRCN0000473914 TTATGTAATCTCTGGTTCAGTATA pLX_317 76% 86.3% 91.2% V5 (many diffs) n/a
Download CSV