Transcript: Mouse NM_009103.3

Mus musculus ribonucleotide reductase M1 (Rrm1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rrm1 (20133)
Length:
3997
CDS:
331..2709

Additional Resources:

NCBI RefSeq record:
NM_009103.3
NBCI Gene record:
Rrm1 (20133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042397 CCATTATCTATGACCGAGATT pLKO.1 731 CDS 100% 4.950 6.930 N Rrm1 n/a
2 TRCN0000042393 GCCAGCTTTGATATTAGGAAT pLKO.1 2902 3UTR 100% 4.950 6.930 N Rrm1 n/a
3 TRCN0000042394 GCCGTCTCTAACTTGCACAAA pLKO.1 574 CDS 100% 4.950 6.930 N Rrm1 n/a
4 TRCN0000042395 CGCGATCTCTTCTTTGCACTT pLKO.1 1306 CDS 100% 4.050 5.670 N Rrm1 n/a
5 TRCN0000038967 CCTGCTCAGATCACCATGAAA pLKO.1 436 CDS 100% 5.625 3.938 N RRM1 n/a
6 TRCN0000042396 GCAGGGTTTAAAGACTGGAAT pLKO.1 2517 CDS 100% 4.950 3.465 N Rrm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06902 pDONR223 100% 90.1% 97.6% None (many diffs) n/a
2 ccsbBroad304_06902 pLX_304 0% 90.1% 97.6% V5 (many diffs) n/a
3 TRCN0000471540 CCGAACCCCTCTTCAGATAGATTT pLX_317 18.3% 90.1% 97.6% V5 (many diffs) n/a
Download CSV