Transcript: Mouse NM_009183.2

Mus musculus ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (St8sia4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
St8sia4 (20452)
Length:
5437
CDS:
334..1413

Additional Resources:

NCBI RefSeq record:
NM_009183.2
NBCI Gene record:
St8sia4 (20452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009183.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093938 CCACCAGATTCTGTGATGAAA pLKO.1 1196 CDS 100% 5.625 7.875 N St8sia4 n/a
2 TRCN0000433164 AGCACGTGGAGTGGGTTAATG pLKO_005 1037 CDS 100% 13.200 10.560 N ST8SIA4 n/a
3 TRCN0000093936 GCCTGAAGTTTCACCAATGAA pLKO.1 717 CDS 100% 5.625 3.938 N St8sia4 n/a
4 TRCN0000093935 GCTGACTAACAAAGTTCCTAT pLKO.1 1137 CDS 100% 4.950 3.465 N St8sia4 n/a
5 TRCN0000093937 CCTGAAGTTTCACCAATGAAA pLKO.1 718 CDS 100% 0.563 0.394 N St8sia4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009183.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07186 pDONR223 100% 42.1% 44.8% None (many diffs) n/a
2 ccsbBroad304_07186 pLX_304 0% 42.1% 44.8% V5 (many diffs) n/a
3 TRCN0000470116 TCTGCCCACCCAGCGGGCCTGAGG pLX_317 3.8% 42.1% 44.8% V5 (many diffs) n/a
Download CSV