Transcript: Mouse NM_009226.4

Mus musculus small nuclear ribonucleoprotein D1 (Snrpd1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Snrpd1 (20641)
Length:
837
CDS:
118..477

Additional Resources:

NCBI RefSeq record:
NM_009226.4
NBCI Gene record:
Snrpd1 (20641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009226.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295004 GTAGTGAGTATCTACTATATT pLKO_005 611 3UTR 100% 15.000 21.000 N Snrpd1 n/a
2 TRCN0000123401 TCGAGGCAATAACATTCGGTA pLKO.1 297 CDS 100% 2.640 3.696 N Snrpd1 n/a
3 TRCN0000123400 CGAGGCAATAACATTCGGTAT pLKO.1 298 CDS 100% 4.050 3.240 N Snrpd1 n/a
4 TRCN0000123399 GTACTGAACATGGGTTTGATT pLKO.1 678 3UTR 100% 5.625 3.938 N Snrpd1 n/a
5 TRCN0000123402 ACACACCTTAAAGCTGTGAAA pLKO.1 229 CDS 100% 4.950 3.465 N Snrpd1 n/a
6 TRCN0000295005 CGATAATGTCTCTCAAGATTA pLKO_005 472 CDS 100% 13.200 6.600 Y Snrpd1 n/a
7 TRCN0000295003 ACACAAGTCCATGGAACAATC pLKO_005 184 CDS 100% 10.800 5.400 Y Snrpd1 n/a
8 TRCN0000295073 ATTGAGTCATGAAACTGTAAC pLKO_005 144 CDS 100% 10.800 5.400 Y Snrpd1 n/a
9 TRCN0000123403 GATACACTACTTGTGGATGTT pLKO.1 346 CDS 100% 4.950 2.475 Y Snrpd1 n/a
10 TRCN0000287520 GATACACTACTTGTGGATGTT pLKO_005 346 CDS 100% 4.950 2.475 Y Snrpd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009226.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469783 GTGTCATAAGCGTCGATGCACCCT pLX_317 84% 94.3% 100% V5 (many diffs) n/a
2 ccsbBroadEn_06983 pDONR223 100% 94.1% 99.1% None (many diffs) n/a
3 ccsbBroad304_06983 pLX_304 0% 94.1% 99.1% V5 (many diffs) n/a
Download CSV