Transcript: Mouse NM_009255.4

Mus musculus serine (or cysteine) peptidase inhibitor, clade E, member 2 (Serpine2), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Serpine2 (20720)
Length:
2071
CDS:
178..1371

Additional Resources:

NCBI RefSeq record:
NM_009255.4
NBCI Gene record:
Serpine2 (20720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009255.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011920 CGATATAATGTAAACGGAGTT pLKO.1 421 CDS 100% 4.050 5.670 N Serpine2 n/a
2 TRCN0000011922 CCTCGTTAATGCAGTGTATTT pLKO.1 723 CDS 100% 13.200 10.560 N Serpine2 n/a
3 TRCN0000011918 CCTGTTGATATGTGTGACTTT pLKO.1 1779 3UTR 100% 4.950 3.465 N Serpine2 n/a
4 TRCN0000011921 CCTTGGCATTACTGAGATGTT pLKO.1 1107 CDS 100% 4.950 3.465 N Serpine2 n/a
5 TRCN0000011919 GCATGATTGATAATCTGCTTT pLKO.1 665 CDS 100% 4.950 3.465 N Serpine2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009255.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01194 pDONR223 100% 84.1% 85.3% None (many diffs) n/a
2 ccsbBroad304_01194 pLX_304 0% 84.1% 85.3% V5 (many diffs) n/a
3 TRCN0000471223 ATCCTGAGCATCCAATCCCGTCTC pLX_317 42.3% 84.1% 85.3% V5 (many diffs) n/a
Download CSV