Transcript: Mouse NM_009275.4

Mus musculus signal recognition particle receptor, B subunit (Srprb), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Srprb (20818)
Length:
2991
CDS:
7..816

Additional Resources:

NCBI RefSeq record:
NM_009275.4
NBCI Gene record:
Srprb (20818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009275.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119830 GTGAAAGATGTGGCCGAATTT pLKO.1 454 CDS 100% 13.200 18.480 N Srprb n/a
2 TRCN0000354096 GTGAAAGATGTGGCCGAATTT pLKO_005 454 CDS 100% 13.200 18.480 N Srprb n/a
3 TRCN0000119829 CGATAGTTCTGCCATATACAA pLKO.1 291 CDS 100% 5.625 7.875 N Srprb n/a
4 TRCN0000326298 CGATAGTTCTGCCATATACAA pLKO_005 291 CDS 100% 5.625 7.875 N Srprb n/a
5 TRCN0000306233 CAGCTCTTAGATCGCTTTAAG pLKO_005 379 CDS 100% 13.200 10.560 N Srprb n/a
6 TRCN0000331382 TCATGTTAGTGTGAGACATAA pLKO_005 1041 3UTR 100% 13.200 9.240 N Srprb n/a
7 TRCN0000119828 CCTTATTAATAGCCTGCAATA pLKO.1 521 CDS 100% 10.800 7.560 N Srprb n/a
8 TRCN0000119827 GCTGTCTTCAACATTTGTGTT pLKO.1 1867 3UTR 100% 4.950 3.465 N Srprb n/a
9 TRCN0000119831 GTTGCCACTCAAAGTGGAGTT pLKO.1 708 CDS 100% 4.050 2.835 N Srprb n/a
10 TRCN0000354097 GTTGCCACTCAAAGTGGAGTT pLKO_005 708 CDS 100% 4.050 2.835 N Srprb n/a
11 TRCN0000063103 GCCTGCAATAAGCAAGATATT pLKO.1 532 CDS 100% 13.200 10.560 N SRPRB n/a
12 TRCN0000299238 GCCTGCAATAAGCAAGATATT pLKO_005 532 CDS 100% 13.200 10.560 N SRPRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009275.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03858 pDONR223 100% 85.1% 90.4% None (many diffs) n/a
2 ccsbBroad304_03858 pLX_304 0% 85.1% 90.4% V5 (many diffs) n/a
3 TRCN0000491785 AGACTTCGCCCGACGGAGCAGGAC pLX_317 34.8% 85.1% 90.4% V5 (many diffs) n/a
Download CSV