Transcript: Mouse NM_009336.2

Mus musculus vacuolar protein sorting 72 (Vps72), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Vps72 (21427)
Length:
1436
CDS:
57..1163

Additional Resources:

NCBI RefSeq record:
NM_009336.2
NBCI Gene record:
Vps72 (21427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085668 GCAAGTCTATGCGTCAGTCTA pLKO.1 445 CDS 100% 4.950 6.930 N Vps72 n/a
2 TRCN0000085671 CGTTCACTCGAGACCTATGAA pLKO.1 609 CDS 100% 0.000 0.000 N Vps72 n/a
3 TRCN0000301913 CGTTCACTCGAGACCTATGAA pLKO_005 609 CDS 100% 0.000 0.000 N Vps72 n/a
4 TRCN0000085670 GTCAGAAGATTGTCATCAAAT pLKO.1 1141 CDS 100% 13.200 10.560 N Vps72 n/a
5 TRCN0000304554 GAAGTGCCCTGGGCCAATAAT pLKO_005 671 CDS 100% 15.000 10.500 N Vps72 n/a
6 TRCN0000085669 AGCCTATAAGGAGCCTCTAAA pLKO.1 317 CDS 100% 13.200 9.240 N Vps72 n/a
7 TRCN0000331588 AGCCTATAAGGAGCCTCTAAA pLKO_005 317 CDS 100% 13.200 9.240 N Vps72 n/a
8 TRCN0000085672 GCGTCAGAAGATTGTCATCAA pLKO.1 1139 CDS 100% 4.950 3.465 N Vps72 n/a
9 TRCN0000301976 GCGTCAGAAGATTGTCATCAA pLKO_005 1139 CDS 100% 4.950 3.465 N Vps72 n/a
10 TRCN0000005686 CCTGTTACAGACATACCCTAT pLKO.1 978 CDS 100% 4.050 2.835 N VPS72 n/a
11 TRCN0000304553 CAGTTCCTCCCTAGTTCATTT pLKO_005 1249 3UTR 100% 13.200 6.600 Y Vps72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.