Transcript: Mouse NM_009366.4

Mus musculus TSC22 domain family, member 1 (Tsc22d1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tsc22d1 (21807)
Length:
1744
CDS:
208..639

Additional Resources:

NCBI RefSeq record:
NM_009366.4
NBCI Gene record:
Tsc22d1 (21807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218486 GTATGTAGTGTAACGAATTTG pLKO_005 1299 3UTR 100% 13.200 18.480 N Tsc22d1 n/a
2 TRCN0000086181 GAGTTTACCAACTGAGACATT pLKO.1 248 CDS 100% 4.950 6.930 N Tsc22d1 n/a
3 TRCN0000301933 GAGTTTACCAACTGAGACATT pLKO_005 248 CDS 100% 4.950 6.930 N Tsc22d1 n/a
4 TRCN0000374229 GGTGCAAGTGTGGTAGCTATC pLKO_005 337 CDS 100% 6.000 4.800 N Tsc22d1 n/a
5 TRCN0000086178 CCATTTCTTTCTTGTCGTCTT pLKO.1 272 CDS 100% 4.050 3.240 N Tsc22d1 n/a
6 TRCN0000234089 AGTTTACCAACTGAGACATTT pLKO_005 249 CDS 100% 13.200 9.240 N Tsc22d1 n/a
7 TRCN0000329864 AGTTTACCAACTGAGACATTT pLKO_005 249 CDS 100% 13.200 9.240 N TSC22D1 n/a
8 TRCN0000086180 CTTCCGTGAGACTTGACAATA pLKO.1 311 CDS 100% 13.200 9.240 N Tsc22d1 n/a
9 TRCN0000234091 CTTCCGTGAGACTTGACAATA pLKO_005 311 CDS 100% 13.200 9.240 N Tsc22d1 n/a
10 TRCN0000374168 TGAGTGAATTAAAGGTTAATC pLKO_005 840 3UTR 100% 13.200 9.240 N Tsc22d1 n/a
11 TRCN0000234090 ATTTCTTTCTTGTCGTCTTTG pLKO_005 274 CDS 100% 10.800 7.560 N Tsc22d1 n/a
12 TRCN0000374228 CCAGTATTAAGCACTCATAAG pLKO_005 793 3UTR 100% 10.800 7.560 N Tsc22d1 n/a
13 TRCN0000013289 GCAGGAGAACAATCTGCTGAA pLKO.1 480 CDS 100% 4.050 2.835 N TSC22D1 n/a
14 TRCN0000086179 GAGCAGATCAAAGAACTAATA pLKO.1 439 CDS 100% 13.200 7.920 N Tsc22d1 n/a
15 TRCN0000234092 GAGCAGATCAAAGAACTAATA pLKO_005 439 CDS 100% 13.200 7.920 N Tsc22d1 n/a
16 TRCN0000086182 GTTCTGAAGGAGCAGATCAAA pLKO.1 430 CDS 100% 5.625 3.375 N Tsc22d1 n/a
17 TRCN0000329852 GGTGCAAGTGTGGTAGCTATT pLKO_005 337 CDS 100% 10.800 8.640 N TSC22D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02032 pDONR223 100% 92.3% 98.6% None (many diffs) n/a
2 ccsbBroad304_02032 pLX_304 0% 92.3% 98.6% V5 (many diffs) n/a
Download CSV