Transcript: Mouse NM_009369.4

Mus musculus transforming growth factor, beta induced (Tgfbi), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tgfbi (21810)
Length:
2678
CDS:
45..2096

Additional Resources:

NCBI RefSeq record:
NM_009369.4
NBCI Gene record:
Tgfbi (21810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009369.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434053 TCAAACAGGCGTCAGCGTATT pLKO_005 2005 CDS 100% 10.800 15.120 N Tgfbi n/a
2 TRCN0000420454 ATACATGGGCTGCACCATATT pLKO_005 2201 3UTR 100% 13.200 9.240 N Tgfbi n/a
3 TRCN0000054808 GCCTTGGCATGGTTCTGTAAA pLKO.1 2471 3UTR 100% 13.200 9.240 N Tgfbi n/a
4 TRCN0000054809 CGAGTCTTTGTTTATCGAAAT pLKO.1 1434 CDS 100% 10.800 7.560 N Tgfbi n/a
5 TRCN0000054811 CCTCCAGAAGAACTGAACAAA pLKO.1 1695 CDS 100% 5.625 3.938 N Tgfbi n/a
6 TRCN0000054812 GCCATTGACATCCTCAAACAA pLKO.1 1215 CDS 100% 5.625 3.938 N Tgfbi n/a
7 TRCN0000054810 CCCAATGGGATTGTAACTGTT pLKO.1 660 CDS 100% 4.950 3.465 N Tgfbi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009369.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07058 pDONR223 100% 86.9% 90.6% None (many diffs) n/a
2 ccsbBroad304_07058 pLX_304 0% 86.9% 90.6% V5 (many diffs) n/a
3 TRCN0000474734 CTTAGTCTTCGACATTTGTTCATT pLX_317 8% 86.9% 90.6% V5 (many diffs) n/a
4 ccsbBroadEn_15609 pDONR223 0% 86.9% 90.6% None (many diffs) n/a
5 ccsbBroad304_15609 pLX_304 0% 86.9% 90.6% V5 (many diffs) n/a
6 TRCN0000472829 TAGATGTGCTAAATATTCCGTAAC pLX_317 15.9% 86.9% 90.6% V5 (many diffs) n/a
Download CSV