Transcript: Mouse NM_009393.2

Mus musculus troponin C, cardiac/slow skeletal (Tnnc1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tnnc1 (21924)
Length:
703
CDS:
44..529

Additional Resources:

NCBI RefSeq record:
NM_009393.2
NBCI Gene record:
Tnnc1 (21924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104630 CCGAATTGACTATGACGAGTT pLKO.1 481 CDS 100% 4.050 5.670 N Tnnc1 n/a
2 TRCN0000104633 ACAGGTGAGACCATTACGGAA pLKO.1 413 CDS 100% 2.640 3.696 N Tnnc1 n/a
3 TRCN0000104634 GTCGGATCTCTTCCGCATGTT pLKO.1 334 CDS 100% 4.950 3.960 N Tnnc1 n/a
4 TRCN0000104631 ACAGTGGACTTCGATGAGTTT pLKO.1 254 CDS 100% 4.950 3.465 N Tnnc1 n/a
5 TRCN0000054217 TGCATGAAGGACGACAGCAAA pLKO.1 293 CDS 100% 4.950 3.465 N TNNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01690 pDONR223 100% 91% 99.3% None (many diffs) n/a
2 ccsbBroad304_01690 pLX_304 0% 91% 99.3% V5 (many diffs) n/a
3 TRCN0000467478 ACTCGGTACCATACATTACAAACG pLX_317 84.4% 91% 99.3% V5 (many diffs) n/a
Download CSV