Transcript: Mouse NM_009407.2

Mus musculus transition protein 1 (Tnp1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tnp1 (21958)
Length:
431
CDS:
37..204

Additional Resources:

NCBI RefSeq record:
NM_009407.2
NBCI Gene record:
Tnp1 (21958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093139 GCGATGATGCAAGTCGCAATT pLKO.1 167 CDS 100% 10.800 15.120 N Tnp1 n/a
2 TRCN0000093142 GCAATTACCGATCCCACTTGT pLKO.1 182 CDS 100% 4.950 6.930 N Tnp1 n/a
3 TRCN0000093140 TCATGGCATGAGGAGAGGCAA pLKO.1 63 CDS 100% 2.640 3.696 N Tnp1 n/a
4 TRCN0000093138 GCCCTGGTGGTCTTCAAACAA pLKO.1 221 3UTR 100% 5.625 3.938 N Tnp1 n/a
5 TRCN0000093141 AGAGAGGTGGAAGCAAGAGAA pLKO.1 110 CDS 100% 4.950 3.465 N Tnp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01695 pDONR223 100% 89% 87.2% None (many diffs) n/a
2 ccsbBroad304_01695 pLX_304 0% 89% 87.2% V5 (many diffs) n/a
3 TRCN0000491558 TGCAATAGGCCTATGCTGTGCTTG pLX_317 100% 89% 87.2% V5 (many diffs) n/a
Download CSV