Transcript: Mouse NM_009422.3

Mus musculus TNF receptor-associated factor 2 (Traf2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Traf2 (22030)
Length:
3044
CDS:
111..1616

Additional Resources:

NCBI RefSeq record:
NM_009422.3
NBCI Gene record:
Traf2 (22030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009422.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234200 ACGGAGTGTCCTGCATGTAAA pLKO_005 510 CDS 100% 13.200 18.480 N Traf2 n/a
2 TRCN0000360563 TAGTTCGGCCTTTCCAGATAA pLKO_005 371 CDS 100% 13.200 18.480 N Traf2 n/a
3 TRCN0000360562 GACGTTTCAGGACCATGTTAG pLKO_005 710 CDS 100% 10.800 15.120 N Traf2 n/a
4 TRCN0000234201 TTTAATCAGAAGGTAACATTG pLKO_005 1386 CDS 100% 10.800 15.120 N Traf2 n/a
5 TRCN0000077231 CCTTGAAAGAATACGAGAGCT pLKO.1 460 CDS 100% 2.640 3.696 N Traf2 n/a
6 TRCN0000360564 GTGGGCAGGCTTGGTGTAAAT pLKO_005 1688 3UTR 100% 13.200 9.240 N Traf2 n/a
7 TRCN0000218150 CGATCTTCATCAAAGCTATTG pLKO_005 1576 CDS 100% 10.800 7.560 N Traf2 n/a
8 TRCN0000077229 GCGATCTTCATCAAAGCTATT pLKO.1 1575 CDS 100% 10.800 7.560 N Traf2 n/a
9 TRCN0000360580 TGGACCTGGAGGTACACTATG pLKO_005 628 CDS 100% 10.800 7.560 N Traf2 n/a
10 TRCN0000077230 GAGTTGGAAGTATCCACCTAT pLKO.1 1140 CDS 100% 4.950 3.465 N Traf2 n/a
11 TRCN0000077228 GCCTGGTTTGCACAATAGGAA pLKO.1 2364 3UTR 100% 3.000 2.100 N Traf2 n/a
12 TRCN0000234202 TCACTTCTGCCTTACTCATTC pLKO_005 2221 3UTR 100% 10.800 6.480 N Traf2 n/a
13 TRCN0000077232 GCCCTGAGTAACAAGGTGCAA pLKO.1 1056 CDS 100% 2.640 1.584 N Traf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009422.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01710 pDONR223 100% 83.9% 86.8% None (many diffs) n/a
2 ccsbBroad304_01710 pLX_304 30.6% 83.9% 86.8% V5 (many diffs) n/a
3 TRCN0000469099 CTCCTAACGACTTCTATATGAGAT pLX_317 30.6% 83.9% 86.8% V5 (many diffs) n/a
Download CSV