Transcript: Mouse NM_009431.2

Mus musculus CTR9 homolog, Paf1/RNA polymerase II complex component (Ctr9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ctr9 (22083)
Length:
4317
CDS:
187..3708

Additional Resources:

NCBI RefSeq record:
NM_009431.2
NBCI Gene record:
Ctr9 (22083)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216886 GATGATAGCGACTAGGTTTAT pLKO.1 3694 CDS 100% 13.200 18.480 N Ctr9 n/a
2 TRCN0000249705 GATGATAGCGACTAGGTTTAT pLKO_005 3694 CDS 100% 13.200 18.480 N Ctr9 n/a
3 TRCN0000174026 CCAGGAATAGCAACAGCGATT pLKO.1 3287 CDS 100% 4.050 3.240 N Ctr9 n/a
4 TRCN0000249706 AGAAGTTTGAGAGGATATTAA pLKO_005 1943 CDS 100% 15.000 10.500 N Ctr9 n/a
5 TRCN0000257913 ATGGGTTGGGAGGAGCTTTAT pLKO_005 3730 3UTR 100% 13.200 9.240 N Ctr9 n/a
6 TRCN0000249707 CTGTCACCACATCCTACAATT pLKO_005 1673 CDS 100% 13.200 9.240 N Ctr9 n/a
7 TRCN0000249704 GGGATACTGACGAGGTCATTG pLKO_005 218 CDS 100% 10.800 7.560 N Ctr9 n/a
8 TRCN0000174590 GCTGCTATGTACAAACTTGTA pLKO.1 4060 3UTR 100% 4.950 3.465 N Ctr9 n/a
9 TRCN0000194617 GCGCTGGAATACTACAAGCAA pLKO.1 328 CDS 100% 3.000 2.100 N Ctr9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.