Transcript: Mouse NM_009510.2

Mus musculus ezrin (Ezr), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Ezr (22350)
Length:
3070
CDS:
138..1898

Additional Resources:

NCBI RefSeq record:
NM_009510.2
NBCI Gene record:
Ezr (22350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379840 TGCCAAACAGGTCAGATTTAA pLKO_005 2087 3UTR 100% 15.000 21.000 N Ezr n/a
2 TRCN0000071883 CCTGAGAATTAACAAGCGGAT pLKO.1 956 CDS 100% 2.160 3.024 N Ezr n/a
3 TRCN0000335193 CCTGAGAATTAACAAGCGGAT pLKO_005 956 CDS 100% 2.160 3.024 N Ezr n/a
4 TRCN0000071887 GCCCTTGGACTTAACATTTAT pLKO.1 801 CDS 100% 15.000 10.500 N Ezr n/a
5 TRCN0000335192 GCCCTTGGACTTAACATTTAT pLKO_005 801 CDS 100% 15.000 10.500 N Ezr n/a
6 TRCN0000381842 GCAAGGCAGGGACAAGTATAA pLKO_005 1814 CDS 100% 13.200 9.240 N Ezr n/a
7 TRCN0000382031 GCTGTGTTCCAGTCCCTTAAA pLKO_005 1990 3UTR 100% 13.200 9.240 N Ezr n/a
8 TRCN0000348506 ACAATGAGCTCAAATCGATTT pLKO_005 2231 3UTR 100% 10.800 7.560 N Ezr n/a
9 TRCN0000071886 CGGAGATTATAACAAGGAAAT pLKO.1 539 CDS 100% 10.800 7.560 N Ezr n/a
10 TRCN0000335191 CGGAGATTATAACAAGGAAAT pLKO_005 539 CDS 100% 10.800 7.560 N Ezr n/a
11 TRCN0000071884 CCAGTGTATGAGCCTGTGAAT pLKO.1 1563 CDS 100% 4.950 3.465 N Ezr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01770 pDONR223 100% 88.6% 96.5% None (many diffs) n/a
2 ccsbBroad304_01770 pLX_304 0% 88.6% 96.5% V5 (many diffs) n/a
3 TRCN0000480271 TGAGCGGCTGTTCCAGTTAATACA pLX_317 26.8% 88.6% 96.5% V5 (many diffs) n/a
Download CSV