Transcript: Mouse NM_009516.3

Mus musculus WEE 1 homolog 1 (S. pombe) (Wee1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Wee1 (22390)
Length:
3419
CDS:
292..2232

Additional Resources:

NCBI RefSeq record:
NM_009516.3
NBCI Gene record:
Wee1 (22390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274665 ATCTACCGAAAGCAGATATTT pLKO_005 1769 CDS 100% 15.000 21.000 N Wee1 n/a
2 TRCN0000274666 CTAGAGCCCACTTCGTGATTA pLKO_005 2308 3UTR 100% 13.200 18.480 N Wee1 n/a
3 TRCN0000274663 CTTTGGTTCACATGGATATAA pLKO_005 1550 CDS 100% 15.000 10.500 N Wee1 n/a
4 TRCN0000274664 CGCTCTGTCAGCCTTACTATA pLKO_005 2206 CDS 100% 13.200 9.240 N Wee1 n/a
5 TRCN0000025670 GCTTTCCAAAGCGCGAGTTAT pLKO.1 873 CDS 100% 13.200 9.240 N Wee1 n/a
6 TRCN0000025673 GAGATGAAGATGACTGGATAT pLKO.1 1628 CDS 100% 10.800 7.560 N Wee1 n/a
7 TRCN0000025672 GCAACATGAAGTCACGGTATA pLKO.1 1154 CDS 100% 10.800 7.560 N Wee1 n/a
8 TRCN0000323421 GCAACATGAAGTCACGGTATA pLKO_005 1154 CDS 100% 10.800 7.560 N Wee1 n/a
9 TRCN0000025669 GCAGAGCAGTTACGAATAGAA pLKO.1 2017 CDS 100% 5.625 3.938 N Wee1 n/a
10 TRCN0000025671 CCACCCAGAGTAATAGAACTT pLKO.1 2159 CDS 100% 4.950 3.465 N Wee1 n/a
11 TRCN0000001702 GCCTTGTGAATTTGCTGCTAT pLKO.1 2776 3UTR 100% 4.950 3.465 N WEE1 n/a
12 TRCN0000218323 ATGGATGCATTTATGCCATTA pLKO_005 1250 CDS 100% 10.800 6.480 N WEE1 n/a
13 TRCN0000001700 CCACCCAGAGTAATAGAACAT pLKO.1 2159 CDS 100% 4.950 3.465 N WEE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489041 CACATTGGCTCCGGCCTGGTTTAT pLX_317 20.7% 86.8% 90.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488292 TCCAGAGCGACCATCCGGCACCAC pLX_317 14% 86.7% 90.1% V5 (many diffs) n/a
Download CSV