Transcript: Mouse NM_009520.3

Mus musculus wingless-type MMTV integration site family, member 2B (Wnt2b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Wnt2b (22414)
Length:
3573
CDS:
238..1407

Additional Resources:

NCBI RefSeq record:
NM_009520.3
NBCI Gene record:
Wnt2b (22414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088924 CCGGACTGATCTTGTCTACTT pLKO.1 1116 CDS 100% 4.950 6.930 N Wnt2b n/a
2 TRCN0000088926 GCGGCAGTTGTGTCAACGCTA pLKO.1 477 CDS 100% 0.880 1.232 N Wnt2b n/a
3 TRCN0000088923 CCCAGCTATTTACTCTCTATT pLKO.1 2684 3UTR 100% 13.200 10.560 N Wnt2b n/a
4 TRCN0000088925 CTGTAGTGACAACATCCATTA pLKO.1 792 CDS 100% 10.800 7.560 N Wnt2b n/a
5 TRCN0000033374 CGGACTGATCTTGTCTACTTT pLKO.1 1117 CDS 100% 5.625 3.938 N WNT2B n/a
6 TRCN0000088927 GCAGCAAGACTTCTAAAGGAA pLKO.1 1205 CDS 100% 3.000 1.800 N Wnt2b n/a
7 TRCN0000373900 ACACGTCCTGGTGGTACATTG pLKO_005 401 CDS 100% 10.800 7.560 N WNT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.