Transcript: Mouse NM_009522.2

Mus musculus wingless-type MMTV integration site family, member 3A (Wnt3a), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Wnt3a (22416)
Length:
2791
CDS:
105..1163

Additional Resources:

NCBI RefSeq record:
NM_009522.2
NBCI Gene record:
Wnt3a (22416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089119 GCCACGTTACACGTACTTCAA pLKO.1 875 CDS 100% 4.950 6.930 N Wnt3a n/a
2 TRCN0000089121 ACCCAACTTCTGCGAACCTAA pLKO.1 935 CDS 100% 4.950 3.960 N Wnt3a n/a
3 TRCN0000244630 GGAACTACGTGGAGATCATGC pLKO_005 274 CDS 100% 4.050 3.240 N WNT3A n/a
4 TRCN0000089120 CGCCAGTCACATGCACCTCAA pLKO.1 689 CDS 100% 1.350 1.080 N Wnt3a n/a
5 TRCN0000089122 TGTAGTGAGGACATTGAATTT pLKO.1 567 CDS 100% 13.200 9.240 N Wnt3a n/a
6 TRCN0000089118 CCTCACTTTGAGTTGTATGAA pLKO.1 2234 3UTR 100% 5.625 3.938 N Wnt3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12922 pDONR223 100% 80% 87.7% None (many diffs) n/a
2 ccsbBroad304_12922 pLX_304 0% 80% 87.7% V5 (many diffs) n/a
3 TRCN0000478391 CTGCCTAATTGCGACCAGTAACCA pLX_317 25.3% 80% 87.7% V5 (many diffs) n/a
Download CSV