Transcript: Mouse NM_009528.3

Mus musculus wingless-type MMTV integration site family, member 7B (Wnt7b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Wnt7b (22422)
Length:
3389
CDS:
372..1421

Additional Resources:

NCBI RefSeq record:
NM_009528.3
NBCI Gene record:
Wnt7b (22422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071782 CGGAGCATTGTCATCCGTGGT pLKO.1 440 CDS 100% 0.720 0.936 N Wnt7b n/a
2 TRCN0000071780 ACCCGATGCCATCATTGTGAT pLKO.1 536 CDS 100% 4.950 3.960 N Wnt7b n/a
3 TRCN0000071778 CGGCTCTGTGAAATAAATATA pLKO.1 2309 3UTR 100% 15.000 10.500 N Wnt7b n/a
4 TRCN0000071781 GCAGCTACGCAGCTACCAGAA pLKO.1 1136 CDS 100% 1.350 0.945 N Wnt7b n/a
5 TRCN0000071779 GCTACCTAAGTTCCGCGAGGT pLKO.1 1022 CDS 100% 0.720 0.504 N Wnt7b n/a
6 TRCN0000061873 CCCGATGCCATCATTGTGATT pLKO.1 537 CDS 100% 4.950 3.960 N WNT7B n/a
7 TRCN0000061874 TGCAACAAGATTCCTGGCCTA pLKO.1 483 CDS 100% 2.160 1.728 N WNT7B n/a
8 TRCN0000061876 CCCACCTTCCTGCGCATCAAA pLKO.1 1116 CDS 100% 1.875 1.313 N WNT7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01781 pDONR223 100% 91.4% 99.1% None (many diffs) n/a
2 ccsbBroad304_01781 pLX_304 0% 91.4% 99.1% V5 (many diffs) n/a
Download CSV