Transcript: Mouse NM_009532.5

Mus musculus X-ray repair complementing defective repair in Chinese hamster cells 1 (Xrcc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Xrcc1 (22594)
Length:
2449
CDS:
454..2349

Additional Resources:

NCBI RefSeq record:
NM_009532.5
NBCI Gene record:
Xrcc1 (22594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009532.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077238 CGGTGGATCTACAGTTGTAAT pLKO.1 2275 CDS 100% 13.200 10.560 N Xrcc1 n/a
2 TRCN0000301396 CGGTGGATCTACAGTTGTAAT pLKO_005 2275 CDS 100% 13.200 10.560 N Xrcc1 n/a
3 TRCN0000077240 CCAGGACAATAGTGACACTGA pLKO.1 1842 CDS 100% 2.640 2.112 N Xrcc1 n/a
4 TRCN0000301394 CCAGGACAATAGTGACACTGA pLKO_005 1842 CDS 100% 2.640 2.112 N Xrcc1 n/a
5 TRCN0000222627 CACCCTCAAGAGACCCAAATT pLKO.1 1257 CDS 100% 13.200 9.240 N Xrcc1 n/a
6 TRCN0000301395 CACCCTCAAGAGACCCAAATT pLKO_005 1257 CDS 100% 13.200 9.240 N Xrcc1 n/a
7 TRCN0000077241 CACAGTGTGGACATTGGCAAT pLKO.1 619 CDS 100% 4.050 2.835 N Xrcc1 n/a
8 TRCN0000301397 CACAGTGTGGACATTGGCAAT pLKO_005 619 CDS 100% 4.050 2.835 N Xrcc1 n/a
9 TRCN0000077239 GAACAGGACTATGAGGTCCTT pLKO.1 700 CDS 100% 0.264 0.185 N Xrcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009532.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.