Transcript: Mouse NM_009624.3

Mus musculus adenylate cyclase 9 (Adcy9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Adcy9 (11515)
Length:
7840
CDS:
767..4828

Additional Resources:

NCBI RefSeq record:
NM_009624.3
NBCI Gene record:
Adcy9 (11515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009624.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114988 GCGATCATATAGAACCAGCTA pLKO.1 3046 CDS 100% 2.640 3.696 N Adcy9 n/a
2 TRCN0000114987 CCCTTTAAGATGCAGCAGATT pLKO.1 1916 CDS 100% 4.950 3.960 N Adcy9 n/a
3 TRCN0000114986 GCACAGTTATTCAGGGTTCAT pLKO.1 4973 3UTR 100% 4.950 3.960 N Adcy9 n/a
4 TRCN0000114990 CCCTTCTTGTGGAATCACATT pLKO.1 2656 CDS 100% 4.950 3.465 N Adcy9 n/a
5 TRCN0000114989 GCTGTCCACATGAAATCCAAA pLKO.1 1169 CDS 100% 4.950 3.465 N Adcy9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009624.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05773 pDONR223 100% 86.6% 92.1% None (many diffs) n/a
2 ccsbBroad304_05773 pLX_304 0% 86.6% 92.1% V5 (many diffs) n/a
3 TRCN0000475791 AAAAGGGTTAAATCTTGTTTCGAC pLX_317 9.1% 86.6% 92.1% V5 (many diffs) n/a
Download CSV