Transcript: Mouse NM_009659.2

Mus musculus arachidonate 12-lipoxygenase, 12R type (Alox12b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Alox12b (11686)
Length:
2347
CDS:
176..2281

Additional Resources:

NCBI RefSeq record:
NM_009659.2
NBCI Gene record:
Alox12b (11686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076440 CGGTACAACGTCCAGATCAAT pLKO.1 1469 CDS 100% 5.625 7.875 N Alox12b n/a
2 TRCN0000076442 CGGATTCCCAATTCTCATCAA pLKO.1 721 CDS 100% 4.950 6.930 N Alox12b n/a
3 TRCN0000076439 GCTGATCGAATACGTCACAAT pLKO.1 1861 CDS 100% 4.950 6.930 N Alox12b n/a
4 TRCN0000056577 GTACTGCAACTATGTGCAGAT pLKO.1 421 CDS 100% 0.405 0.567 N ALOX12B n/a
5 TRCN0000076438 CCAGTACCTTAATGGTATTAA pLKO.1 973 CDS 100% 15.000 10.500 N Alox12b n/a
6 TRCN0000076441 GTGACAGAGATCATCACTTAT pLKO.1 1712 CDS 100% 13.200 9.240 N Alox12b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00057 pDONR223 100% 83.8% 86% None (many diffs) n/a
2 ccsbBroad304_00057 pLX_304 0% 83.8% 86% V5 (many diffs) n/a
Download CSV