Transcript: Mouse NM_009662.2

Mus musculus arachidonate 5-lipoxygenase (Alox5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Alox5 (11689)
Length:
2827
CDS:
155..2179

Additional Resources:

NCBI RefSeq record:
NM_009662.2
NBCI Gene record:
Alox5 (11689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254912 ACTCGGTAGCATCAGAATAAG pLKO_005 2471 3UTR 100% 13.200 18.480 N Alox5 n/a
2 TRCN0000254915 CTCAAGCAGCACAGACGTAAA pLKO_005 536 CDS 100% 10.800 15.120 N Alox5 n/a
3 TRCN0000217752 CACTCGGTAGCATCAGAATAA pLKO.1 2470 3UTR 100% 13.200 9.240 N Alox5 n/a
4 TRCN0000254914 TTGGCCCGAGATGACCAAATT pLKO_005 509 CDS 100% 13.200 9.240 N Alox5 n/a
5 TRCN0000254913 TTCCTCCCTACGGATTCAAAG pLKO_005 1169 CDS 100% 10.800 7.560 N Alox5 n/a
6 TRCN0000196231 GCAGCTCAGTTTAGAACAGGA pLKO.1 961 CDS 100% 2.640 1.848 N Alox5 n/a
7 TRCN0000056568 CCTGTTCATCAACCGCTTCAT pLKO.1 718 CDS 100% 4.950 2.970 N ALOX5 n/a
8 TRCN0000056570 CGAGATGACCAAATTCACATT pLKO.1 515 CDS 100% 4.950 3.465 N ALOX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00056 pDONR223 100% 88% 93.4% None (many diffs) n/a
2 ccsbBroad304_00056 pLX_304 0% 88% 93.4% V5 (many diffs) n/a
3 TRCN0000480364 GTTAATATGCACTGCGTAAGTTCG pLX_317 19.1% 88% 93.4% V5 (many diffs) n/a
Download CSV