Transcript: Mouse NM_009663.2

Mus musculus arachidonate 5-lipoxygenase activating protein (Alox5ap), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Alox5ap (11690)
Length:
1031
CDS:
110..595

Additional Resources:

NCBI RefSeq record:
NM_009663.2
NBCI Gene record:
Alox5ap (11690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076455 GCATGAAAGCAAGGCGCATAA pLKO.1 202 CDS 100% 10.800 15.120 N Alox5ap n/a
2 TRCN0000076456 CGGAAGCGACTTTGAGAACTA pLKO.1 526 CDS 100% 4.950 3.465 N Alox5ap n/a
3 TRCN0000076454 GCCGGACTGATGTACCTGTTT pLKO.1 365 CDS 100% 4.950 3.465 N Alox5ap n/a
4 TRCN0000076453 GCTCCTCTTCAAGCTGTAGAT pLKO.1 668 3UTR 100% 4.950 3.465 N Alox5ap n/a
5 TRCN0000076457 TGTACCTGTTTGTGAGGCAAA pLKO.1 375 CDS 100% 4.050 2.835 N Alox5ap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05804 pDONR223 100% 86.1% 91.9% None (many diffs) n/a
2 ccsbBroad304_05804 pLX_304 0% 86.1% 91.9% V5 (many diffs) n/a
3 TRCN0000478230 ACCCGTTAACAAATATCATCATCT pLX_317 9.7% 86.1% 91.9% V5 (many diffs) n/a
Download CSV