Transcript: Mouse NM_009705.3

Mus musculus arginase type II (Arg2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Arg2 (11847)
Length:
1417
CDS:
83..1147

Additional Resources:

NCBI RefSeq record:
NM_009705.3
NBCI Gene record:
Arg2 (11847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101864 CACAAGATGATCCCTACAATA pLKO.1 312 CDS 100% 13.200 9.240 N Arg2 n/a
2 TRCN0000101860 GCACCTTTCACAACAGCATTA pLKO.1 1164 3UTR 100% 10.800 7.560 N Arg2 n/a
3 TRCN0000101863 CAGACATTTGATCGGCTGATT pLKO.1 779 CDS 100% 4.950 3.465 N Arg2 n/a
4 TRCN0000101862 GCCACTTTCCTTTCTCATCAA pLKO.1 568 CDS 100% 4.950 3.465 N Arg2 n/a
5 TRCN0000101861 GCCTGGCAATAGGTACCATTA pLKO.1 444 CDS 100% 0.000 0.000 N Arg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00099 pDONR223 100% 85.9% 84.7% None (many diffs) n/a
2 ccsbBroad304_00099 pLX_304 0% 85.9% 84.7% V5 (many diffs) n/a
3 TRCN0000468965 ATTGGGCATGGAAGTTAGTTAGAA pLX_317 44.6% 85.9% 84.7% V5 (many diffs) n/a
Download CSV