Transcript: Mouse NM_009756.3

Mus musculus bone morphogenetic protein 10 (Bmp10), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Bmp10 (12154)
Length:
1325
CDS:
40..1305

Additional Resources:

NCBI RefSeq record:
NM_009756.3
NBCI Gene record:
Bmp10 (12154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067515 GCAAGATGGTATTGACTTCAA pLKO.1 174 CDS 100% 4.950 3.960 N Bmp10 n/a
2 TRCN0000067517 GCTGGAGCTCTACAACAAATT pLKO.1 294 CDS 100% 13.200 9.240 N Bmp10 n/a
3 TRCN0000067513 CCCACTATACATCGACTTCAA pLKO.1 1008 CDS 100% 4.950 3.465 N Bmp10 n/a
4 TRCN0000067516 TCCACATAGAAAGCAGACAAA pLKO.1 704 CDS 100% 4.950 3.465 N Bmp10 n/a
5 TRCN0000174120 TCCACATAGAAAGCAGACAAA pLKO.1 704 CDS 100% 4.950 3.465 N Bmp10 n/a
6 TRCN0000067514 CCGGAAATATCCTCTCCTCTT pLKO.1 408 CDS 100% 4.050 2.835 N Bmp10 n/a
7 TRCN0000178881 CCCATCTCCATCCTCTATTTA pLKO.1 1216 CDS 100% 15.000 9.000 N BMP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08082 pDONR223 100% 83.3% 85.1% None (many diffs) n/a
2 ccsbBroad304_08082 pLX_304 0% 83.3% 85.1% V5 (many diffs) n/a
3 TRCN0000477140 GTCCAAAAGCAATTGACACAACCC pLX_317 28.8% 83.3% 85.1% V5 (many diffs) n/a
Download CSV