Transcript: Mouse NM_009838.2

Mus musculus chaperonin containing Tcp1, subunit 6a (zeta) (Cct6a), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Cct6a (12466)
Length:
2303
CDS:
84..1679

Additional Resources:

NCBI RefSeq record:
NM_009838.2
NBCI Gene record:
Cct6a (12466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120446 CGTGTCCTTAGAGTATGAGAA pLKO.1 785 CDS 100% 4.950 6.930 N Cct6a n/a
2 TRCN0000319996 CGTGTCCTTAGAGTATGAGAA pLKO_005 785 CDS 100% 4.950 6.930 N Cct6a n/a
3 TRCN0000120445 GACTCAAATCAAGGATGCAAT pLKO.1 1235 CDS 100% 4.950 3.465 N Cct6a n/a
4 TRCN0000350145 GACTCAAATCAAGGATGCAAT pLKO_005 1235 CDS 100% 4.950 3.465 N Cct6a n/a
5 TRCN0000120443 GCAGGGCTTGTCTATGAGTAT pLKO.1 1122 CDS 100% 4.950 3.465 N Cct6a n/a
6 TRCN0000350144 GCAGGGCTTGTCTATGAGTAT pLKO_005 1122 CDS 100% 4.950 3.465 N Cct6a n/a
7 TRCN0000120442 CCTGTGATACTACAGGATGTT pLKO.1 1686 3UTR 100% 0.495 0.347 N Cct6a n/a
8 TRCN0000120444 CCTTCAGGAAACATTAGTTAA pLKO.1 1457 CDS 100% 13.200 7.920 N Cct6a n/a
9 TRCN0000320073 CCTTCAGGAAACATTAGTTAA pLKO_005 1457 CDS 100% 13.200 7.920 N Cct6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00241 pDONR223 100% 88.7% 96.7% None (many diffs) n/a
Download CSV