Transcript: Mouse NM_009840.3

Mus musculus chaperonin containing Tcp1, subunit 8 (theta) (Cct8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cct8 (12469)
Length:
2391
CDS:
82..1728

Additional Resources:

NCBI RefSeq record:
NM_009840.3
NBCI Gene record:
Cct8 (12469)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120473 CGGACCAAATGGAATGAATAA pLKO.1 222 CDS 100% 13.200 9.240 N Cct8 n/a
2 TRCN0000320094 CGGACCAAATGGAATGAATAA pLKO_005 222 CDS 100% 13.200 9.240 N Cct8 n/a
3 TRCN0000120476 GCGGACATAGCTCTTCATTAT pLKO.1 973 CDS 100% 13.200 9.240 N Cct8 n/a
4 TRCN0000320157 GCGGACATAGCTCTTCATTAT pLKO_005 973 CDS 100% 13.200 9.240 N Cct8 n/a
5 TRCN0000120475 GCTGTAAAGGATATGTTAGAA pLKO.1 1543 CDS 100% 5.625 3.938 N Cct8 n/a
6 TRCN0000320095 GCTGTAAAGGATATGTTAGAA pLKO_005 1543 CDS 100% 5.625 3.938 N Cct8 n/a
7 TRCN0000120472 CGTCTGTTTAATCACTCACAT pLKO.1 1846 3UTR 100% 4.950 3.465 N Cct8 n/a
8 TRCN0000120474 GCTGAAGAACTTCTGAGGATT pLKO.1 424 CDS 100% 4.950 3.465 N Cct8 n/a
9 TRCN0000350212 GCTGAAGAACTTCTGAGGATT pLKO_005 424 CDS 100% 4.950 3.465 N Cct8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.