Transcript: Mouse NM_009920.4

Mus musculus cornichon family AMPA receptor auxiliary protein 2 (Cnih2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cnih2 (12794)
Length:
1361
CDS:
259..741

Additional Resources:

NCBI RefSeq record:
NM_009920.4
NBCI Gene record:
Cnih2 (12794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109842 GAATGCTGACATCCTCAACTA pLKO.1 627 CDS 100% 4.950 6.930 N Cnih2 n/a
2 TRCN0000109844 GTACAGTATGGTTTATACGTT pLKO.1 708 CDS 100% 3.000 4.200 N Cnih2 n/a
3 TRCN0000109840 GCAGACCTTGATCCTGGAAAT pLKO.1 1052 3UTR 100% 10.800 7.560 N Cnih2 n/a
4 TRCN0000154246 CTTTGTCATCTGGCACATCAT pLKO.1 324 CDS 100% 4.950 3.465 N CNIH2 n/a
5 TRCN0000109841 TCATGTATGATGCGGTCTCTA pLKO.1 602 CDS 100% 4.950 3.465 N Cnih2 n/a
6 TRCN0000153852 CTTCTTTGTCATCTGGCACAT pLKO.1 321 CDS 100% 4.050 2.835 N CNIH2 n/a
7 TRCN0000109843 GCTGTCCTTCTTCTATTACCT pLKO.1 687 CDS 100% 3.000 2.100 N Cnih2 n/a
8 TRCN0000158144 CTGATGTTTCTGTGTGCAGCA pLKO.1 496 CDS 100% 2.160 1.512 N CNIH2 n/a
9 TRCN0000153213 CTCCCTCATCTTCTTTGTCAT pLKO.1 312 CDS 100% 4.950 2.970 N CNIH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05299 pDONR223 100% 97.2% 100% None (many diffs) n/a
2 ccsbBroad304_05299 pLX_304 0% 97.2% 100% V5 (many diffs) n/a
3 TRCN0000467503 CGCAGATAACCCTCGATAACGGCT pLX_317 71.6% 97.2% 100% V5 (many diffs) n/a
Download CSV