Transcript: Mouse NM_010028.3

Mus musculus DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked (Ddx3x), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ddx3x (13205)
Length:
4571
CDS:
92..2080

Additional Resources:

NCBI RefSeq record:
NM_010028.3
NBCI Gene record:
Ddx3x (13205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000001 CCCTGCCAAACAAGCTAATAT pLKO.1 2101 3UTR 100% 15.000 12.000 N DDX3X n/a
2 TRCN0000314601 CCCTGCCAAACAAGCTAATAT pLKO_005 2101 3UTR 100% 15.000 12.000 N DDX3X n/a
3 TRCN0000103753 GTGGAGTTCTAGTAAAGATAA pLKO.1 268 CDS 100% 13.200 10.560 N Ddx3x n/a
4 TRCN0000287239 GTGGAGTTCTAGTAAAGATAA pLKO_005 268 CDS 100% 13.200 10.560 N Ddx3x n/a
5 TRCN0000103754 ACGTTCTAAGAGCAGTCGATT pLKO.1 1849 CDS 100% 4.950 3.960 N Ddx3x n/a
6 TRCN0000287236 ACGTTCTAAGAGCAGTCGATT pLKO_005 1849 CDS 100% 4.950 3.960 N Ddx3x n/a
7 TRCN0000294685 AGCAAGCAAAGGGCGTTATAT pLKO_005 187 CDS 100% 15.000 10.500 N Ddx3x n/a
8 TRCN0000103750 GCTGTGATTCTCCACTGAAAT pLKO.1 2188 3UTR 100% 13.200 9.240 N Ddx3x n/a
9 TRCN0000287305 GCTGTGATTCTCCACTGAAAT pLKO_005 2188 3UTR 100% 13.200 9.240 N Ddx3x n/a
10 TRCN0000103751 CCGTGATTTCTTAGATGAGTA pLKO.1 1270 CDS 100% 4.950 3.465 N Ddx3x n/a
11 TRCN0000103752 CCACCTCATTCTTTAATGAAA pLKO.1 1713 CDS 100% 0.563 0.394 N Ddx3x n/a
12 TRCN0000287238 CCACCTCATTCTTTAATGAAA pLKO_005 1713 CDS 100% 0.563 0.394 N Ddx3x n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.