Transcript: Mouse NM_010050.3

Mus musculus deiodinase, iodothyronine, type II (Dio2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dio2 (13371)
Length:
6432
CDS:
754..1554

Additional Resources:

NCBI RefSeq record:
NM_010050.3
NBCI Gene record:
Dio2 (13371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010050.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099189 ACCTACAAGAAGTCCGAAGTT pLKO.1 1493 CDS 100% 4.950 6.930 N Dio2 n/a
2 TRCN0000099188 CAGGTTAAACTGGGTGAAGAT pLKO.1 973 CDS 100% 4.950 3.465 N Dio2 n/a
3 TRCN0000099186 GCGCTCTATGACTCGGTCATT pLKO.1 829 CDS 100% 4.950 3.465 N Dio2 n/a
4 TRCN0000099185 GCCTTAAATGTAGAAGCCAAA pLKO.1 5233 3UTR 100% 4.050 2.835 N Dio2 n/a
5 TRCN0000099187 CCGCATGGACAATAATGCCAA pLKO.1 1383 CDS 100% 2.640 1.848 N Dio2 n/a
6 TRCN0000084065 GCCTTTGAACGTGTGTGCATT pLKO.1 1420 CDS 100% 4.950 6.930 N DIO2 n/a
7 TRCN0000286957 GCCTTTGAACGTGTGTGCATT pLKO_005 1420 CDS 100% 4.950 6.930 N DIO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010050.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13844 pDONR223 100% 86.4% 87.1% None (many diffs) n/a
2 ccsbBroad304_13844 pLX_304 0% 86.4% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476920 AGGATACCTACAGGCATTCCCACC pLX_317 34.5% 86.4% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV