Transcript: Mouse NM_010111.5

Mus musculus ephrin B2 (Efnb2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Efnb2 (13642)
Length:
4319
CDS:
160..1170

Additional Resources:

NCBI RefSeq record:
NM_010111.5
NBCI Gene record:
Efnb2 (13642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010111.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276587 ATTCCTCGAACTCCAAATTTC pLKO_005 275 CDS 100% 13.200 18.480 N EFNB2 n/a
2 TRCN0000066496 GTGACGTTATCATACCACTAA pLKO.1 1028 CDS 100% 4.950 6.930 N Efnb2 n/a
3 TRCN0000336422 CGGACAAGGCCTGGTACTATA pLKO_005 300 CDS 100% 13.200 10.560 N Efnb2 n/a
4 TRCN0000066493 CGGGTGTTACAGTAGCCTTAT pLKO.1 3817 3UTR 100% 10.800 8.640 N Efnb2 n/a
5 TRCN0000336370 AGGAGACAAATTGGATATTAT pLKO_005 330 CDS 100% 15.000 10.500 N Efnb2 n/a
6 TRCN0000276537 ACTGTTGGCCAGTATGAATAT pLKO_005 373 CDS 100% 13.200 9.240 N EFNB2 n/a
7 TRCN0000336368 GAGCTAGAAGCTGGTACAAAT pLKO_005 718 CDS 100% 13.200 9.240 N Efnb2 n/a
8 TRCN0000066494 GCACAATTAAGAAGGAGAATA pLKO.1 434 CDS 100% 13.200 9.240 N Efnb2 n/a
9 TRCN0000336367 TGCCGTGCACACTGGACTTAT pLKO_005 1518 3UTR 100% 13.200 9.240 N Efnb2 n/a
10 TRCN0000276588 TCTACATCAAATGGGTCTTTG pLKO_005 574 CDS 100% 10.800 7.560 N EFNB2 n/a
11 TRCN0000336397 TCTACATCAAATGGGTCTTTG pLKO_005 574 CDS 100% 10.800 7.560 N Efnb2 n/a
12 TRCN0000066495 CGCATCAGGATGCATCATCTT pLKO.1 861 CDS 100% 4.950 3.465 N Efnb2 n/a
13 TRCN0000058427 CTGGTACTATACCCACAGATA pLKO.1 310 CDS 100% 4.950 3.465 N EFNB2 n/a
14 TRCN0000066497 CCAAGATGTGAAATTCACCAT pLKO.1 483 CDS 100% 2.640 1.848 N Efnb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010111.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00486 pDONR223 100% 92% 95.8% None (many diffs) n/a
2 ccsbBroad304_00486 pLX_304 0% 92% 95.8% V5 (many diffs) n/a
3 TRCN0000469739 GATTGACCGCAAACCTGATAAGTT pLX_317 32% 92% 95.8% V5 (many diffs) n/a
Download CSV