Transcript: Mouse NM_010124.2

Mus musculus eukaryotic translation initiation factor 4E binding protein 2 (Eif4ebp2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Eif4ebp2 (13688)
Length:
1786
CDS:
124..486

Additional Resources:

NCBI RefSeq record:
NM_010124.2
NBCI Gene record:
Eif4ebp2 (13688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075615 CACGAATCATTTATGACCGAA pLKO.1 272 CDS 100% 2.640 3.696 N Eif4ebp2 n/a
2 TRCN0000075614 CGCCTTAATTGAAGACTCCAA pLKO.1 378 CDS 100% 2.640 2.112 N Eif4ebp2 n/a
3 TRCN0000075617 CAAAGTAGAAGTGAACAACTT pLKO.1 396 CDS 100% 4.950 3.465 N Eif4ebp2 n/a
4 TRCN0000075616 CAACTTAAACAACCTGAACAA pLKO.1 411 CDS 100% 4.950 3.465 N Eif4ebp2 n/a
5 TRCN0000075613 CCCTGGTCATTTCCCAAGAAT pLKO.1 737 3UTR 100% 5.625 3.375 N Eif4ebp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00491 pDONR223 100% 91.3% 95% None (many diffs) n/a
2 ccsbBroad304_00491 pLX_304 0% 91.3% 95% V5 (many diffs) n/a
3 TRCN0000465782 CCCACAAGCCCAAGACATCACTGC pLX_317 73.4% 91.3% 95% V5 (many diffs) n/a
Download CSV